NEW DELHI: Students of several govt schools in northeast and east Delhi are allegedly grappling with the discontinuation of English-medium teaching in Class XI. The students are faced with the choice ...

State Street Target Retirement 2055 Non-Lending Series Fund Class A 34.75 Copyright © 2026 Insider Inc and finanzen.net GmbH (Imprint). All rights reserved ...

State Street Target Retirement 2040 Securities Lending Series Fund Class I 29.76 State Street Target Retirement 2040 Securities Lending Series Fund Class IncomeWise ...

A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...

Chinese President Xi Jinping landed in Pyongyang on Monday for a two-day visit, his first to North Korea since 2019. North Korea leader Kim Jong-un and his wife Ri Sol-ju gave Xi and first lady Peng ...

Chinese President Xi Jinping received an elaborate welcome upon arriving in North Korea, kicking off a visit aimed at reasserting Beijing’s influence over an emboldened neighbor with an expanding ...

BEIJING — Chinese leader Xi Jinping will travel to North Korea next week, both countries announced Friday, in what will be his first visit in nearly seven years. His trip will be the latest in a ...

Chinese leader Xi Jinping’s first visit to North Korea in seven years wasn’t just loaded with rhetoric hailing historic ties between China and its longstanding – and only – treaty ally. Instead, the ...

Chinese leader Xi Jinping called for deepening “strategic coordination and cooperation” with North Korea shortly after receiving a pomp-filled welcome to mark his first visit to the secluded nation in ...

Xi Jinping will travel to North Korea next week for a rare visit just weeks after the Chinese leader hosted US President Donald Trump and Russian leader Vladimir Putin for separate, nearly ...

The summer recruiting window is officially open, commitments are flying off the board, and the Rivals Industry Team Recruiting Rankings are changing by the hour. Following the first weekend of ...

WHEN XI JINPING last visited North Korea, in 2019, international efforts to halt its nuclear-weapons programme were still under way. China and Russia, North Korea’s longtime patrons, had backed ...